Claudia Boehnisch und University - Info zur Person

(1 - 6 von 7

)

Past members – May LabUniversity of Birmingham

more.bham.ac.uk

Nicola Cumley Clinical Microbiologist, Queen Elizabeth Hospital ; Elizabeth Marsh Lecturer, University of Derby ; Claudia Boehnisch Regulatory Affairs Manager,

Host-pathogen interactions in the innate immune response ...University of Birmingham

etheses.bham.ac.uk

von EK Marsh · — Kindly provided by Claudia Boehnisch. Reverse CCAGTGACTCCACCGCTGTA abl-1. Forward TGCATCAGAGGAGTTTGAGA Primer 3 (v0.4.0). Reverse ATTGTCAGCGTCAGTGCTT fat- ...

Diversification and adaptive sequence evolution of BioMed Centralwww.yumpu.com › document › view › diversificati...

www.yumpu.com

Hinrich Schulenburg* and Claudia Boehnisch. Open Access. Address: Department of Animal Evolutionary Ecology, Zoological Institute, University of Tuebingen, ...

BMC Evolutionary Biology BioMed Central

www.bing.com

WitrynaHinrich Schulenburg* and Claudia Boehnisch Address: Department of Animal Evolutionary Ecology, Zoological Institute, University of Tuebingen, Auf der …

BMC Evolutionary Biologyebsco

search.ebscohost.com

von H Schulenburg · · Zitiert von: 79 — Hinrich Schulenburg* and Claudia Boehnisch. Address: Department of Animal Evolutionary Ecology, Zoological Institute, University of Tuebingen, ...

Phenotypic Covariance of Longevity, Immunity and Stress ...University of Birmingham

research.birmingham.ac.uk

Phenotypic Covariance of Longevity, Immunity and Stress Resistance in the Caenorhabditis Nematodes. FRG Amrit, Claudia Boehnisch, Robin May · Biosciences.

Alle Infos zum Namen "Claudia Boehnisch"

Verwandte Suchanfragen zu Claudia Boehnisch

Vanessa Brown
Nico Michiels
Kerstin Isermann

Thomas Roeder

Personen
Vorname "Claudia" (71176)
Name "Boehnisch" (26)

sortiert nach Relevanz / Datum

Erweiterte Suche

Person-Suchen: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Claudia Boehnisch und University Person-Info